{"id":691,"date":"2016-11-07T22:11:37","date_gmt":"2016-11-07T22:11:37","guid":{"rendered":"http:\/\/biodigestor.net\/?p=691"},"modified":"2016-11-07T22:11:37","modified_gmt":"2016-11-07T22:11:37","slug":"%ce%b3%ce%b4-t-cells-are-generated-within-the-thymus-and-traffic-to","status":"publish","type":"post","link":"https:\/\/biodigestor.net\/?p=691","title":{"rendered":"\u03b3\u03b4 T cells are generated within the thymus and traffic to"},"content":{"rendered":"

\u03b3\u03b4 T cells are generated within the thymus and traffic to secondary lymphoid organs and epithelial surfaces where they regulate immune responses. expectation from published work. Interestingly KLF2 but not S1P1 deficiency led to the expansion of a usually rare population of CD4+ PLZF+ \u201c\u03b3\u03b4 NKT cells\u201d. Thus KLF2 Byakangelicol is critically important for the homeostasis and trafficking of \u03b3\u03b4 T cells. INTRODUCTION T cell progenitors with an MHC restricted TCR undergo positive selection in the thymus at the CD4 CD8 double positive (DP) stage and become a CD4+ or CD8+ single positive (SP) \u03b1\u03b2 T cell as they enter the thymic medulla. After maturation \u03b1\u03b2 T cells emigrate from the thymus to seed peripheral lymphoid organs. The sphingolipid receptor sphingosine 1-phosphate receptor 1 (S1P1) is required for thymic emigration and is only expressed at high levels by fully mature thymocytes (1). Likewise only mature thymocytes exhibit Compact disc62L (L-selectin) that is required to access peripheral lymph nodes through the bloodstream (2 3 We lately showed the fact that transcription aspect Kr\u00fcppel-like aspect 2 (KLF2 previously called LKLF) is necessary for appearance of S1P1 and Compact disc62L in thymocytes (4). KLF2 transactivates both S1P1 and Mouse monoclonal antibody to TBL1Y. The protein encoded by this gene has sequence similarity with members of the WD40 repeatcontainingprotein family. The WD40 group is a large family of proteins, which appear to have aregulatory function. It is believed that the WD40 repeats mediate protein-protein interactions andmembers of the family are involved in signal transduction, RNA processing, gene regulation,vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypicdifferentiation. This gene is highly similar to TBL1X gene in nucleotide sequence and proteinsequence, but the TBL1X gene is located on chromosome X and this gene is on chromosome Y.This gene has three alternatively spliced transcript variants encoding the same protein.<\/a> Compact disc62L promoters (4-6). Research in KLF2-lacking mice showed a build up of Compact disc4+ and Compact disc8+ \u03b1\u03b2 thymocytes within the thymus and too little \u03b1\u03b2 T cells in supplementary lymphoid organs (4). These results suggest that a crucial function of KLF2 in T cells would be to stimulate expression of substances necessary for na?ve T cell trafficking. \u03b3\u03b4 T cells from E17 fetal thymocytes have already been reported expressing S1P1 as dependant on real-time PCR (7). Nonetheless it is certainly unclear if S1P1 appearance would depend on KLF2 since it is in \u03b1\u03b2 T cells or if it plays a functional role. Indeed evidence with the S1P1 analogue FTY720 suggest that splenic \u03b3\u03b4 T cells rely on S1P1 but that gut homing\u03b3\u03b4 T cells do not (8). In this study we report that KLF2 (and S1P1) are expressed in \u03b3\u03b4 thymocytes. Interestingly we find that KLF2-deficiency in hematopoietic stem cells leads to a reduced frequency of conventional \u03b3\u03b4 T cells in the peripheral lymphoid pool but an increased incidence of promyelocytic leukemia zinc finger (PLZF)+ \u03b3\u03b4 natural killer T cells (\u03b3\u03b4 NKT) (9 10 Furthermore we show that both KLF2 and S1P1 are required for localization of \u03b3\u03b4 T cells (and Byakangelicol<\/a> CD8\u03b1\u03b1+ \u03b1\u03b2 T cells) in the gut. Overall our findings suggest that KLF2 regulates lymphoid homeostasis -affecting the composition and distribution of \u03b3\u03b4 T cell populations in steady state. MATERIALS AND METHODS Mice C57BL\/6 (B6) and CD45.1+ congenic B6.SJL-(B6.SJL) mice were purchased from Jackson Labs. (14) using the Foxp3 staining buffer set (eBioscience San Diego CA). After washing cells were then stained with anti-mouse IgG1-APC in 1\u00d7 permeabilization buffer and re-washed. All cells were analyzed on Becton Dickinson LSR II instruments and the data was processed using FlowJo (Tree Star Ashland OR) software. Cell Sorting and Real-time PCR Fluorescence-activated cell sorting (FACS) was used to purify CD4+CD8+ DP \u201cdump\u201d unfavorable CD4+SP and double unfavorable GL3+ NK1.1\/CD1d- CD25-\u03b3\u03b4 T cells. Each group was sorted in at least two impartial experiments. For cell sorting CD8 T cells were first depleted with anti-CD8 FITC using MACS magnetic beads (Miltenyl Biotec Auburn CA). Sorting was performed on a FACSVantage (Becton Dickinson) and was reliably >90% of target population. RNA was isolated from sorted populations using the Byakangelicol RNeasy kit Qiagen (Valencia CA) and cDNA was produced using the SuperScriptIII Platinum Two-Step qRT-PCR kit Invitrogen (Carlsbad CA). cDNA was prepared a minimum of from each kind twice. PCR products had been amplified using QuantiTect SYBR Green PCR package from Qiagen and discovered using ABI Prism 7000 Series Detection Program (Applied Biosystems USA). HPRT was utilized to normalize examples. Primers were the following; HPRT (hypoxanthine-guanine phosphoribosyl transferase): CTTCCTCCTCAGACCGCTTT & ACCTGGTTCATCATCGCTAA S1P1: GTGTAGACCCAGAGTCCTGCG & AGCTTTTCCTTGGCTGGAGAG KLF2: Byakangelicol AGCCTATCTTGCCGTCCTTT & CGCCTCGGGTTCATTTC Compact disc62L: GTGGAGCATCTGGAAACTGG & CGGCTACAGGAATGAAGAGG and \u03b27 Integrin: GGACGACTTGGAACGTGTG and CGTTTTGTCCACGAAGGAG. Flip changes were computed utilizing the \u0394\u0394Ct technique with DP beliefs as baseline. Statistical Evaluation Statistical evaluation using unpaired student\u2019s suggested that \u03b3\u03b4 T cells and.<\/p>\n","protected":false},"excerpt":{"rendered":"

\u03b3\u03b4 T cells are generated within the thymus and traffic to secondary lymphoid organs and epithelial surfaces where they regulate immune responses. expectation from published work. Interestingly KLF2 but not S1P1 deficiency led to the expansion of a usually rare population of CD4+ PLZF+ \u201c\u03b3\u03b4 NKT cells\u201d. Thus KLF2 Byakangelicol is critically important for the… Continue reading \u03b3\u03b4 T cells are generated within the thymus and traffic to<\/span><\/a><\/p>\n","protected":false},"author":1,"featured_media":0,"comment_status":"closed","ping_status":"closed","sticky":false,"template":"","format":"standard","meta":{"footnotes":""},"categories":[85],"tags":[666,667,665,663,660,662,664,661],"class_list":["post-691","post","type-post","status-publish","format-standard","hentry","category-5-hydroxytryptamine-receptors","tag-but-the-tbl1x-gene-is-located-on-chromosome-x-and-this-gene-is-on-chromosome-y-this-gene-has-three-alternatively-spliced-transcript-variants-encoding-the-same-protein","tag-byakangelicol","tag-cytoskeletal-assembly-and-may-play-a-role-in-the-control-of-cytotypicdifferentiation-this-gene-is-highly-similar-to-tbl1x-gene-in-nucleotide-sequence-and-proteinsequence","tag-gene-regulation","tag-mouse-monoclonal-antibody-to-tbl1y-the-protein-encoded-by-this-gene-has-sequence-similarity-with-members-of-the-wd40-repeatcontainingprotein-family-the-wd40-group-is-a-large-family-of-proteins","tag-rna-processing","tag-vesicular-trafficking","tag-which-appear-to-have-aregulatory-function-it-is-believed-that-the-wd40-repeats-mediate-protein-protein-interactions-andmembers-of-the-family-are-involved-in-signal-transduction","entry"],"_links":{"self":[{"href":"https:\/\/biodigestor.net\/index.php?rest_route=\/wp\/v2\/posts\/691"}],"collection":[{"href":"https:\/\/biodigestor.net\/index.php?rest_route=\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/biodigestor.net\/index.php?rest_route=\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/biodigestor.net\/index.php?rest_route=\/wp\/v2\/users\/1"}],"replies":[{"embeddable":true,"href":"https:\/\/biodigestor.net\/index.php?rest_route=%2Fwp%2Fv2%2Fcomments&post=691"}],"version-history":[{"count":1,"href":"https:\/\/biodigestor.net\/index.php?rest_route=\/wp\/v2\/posts\/691\/revisions"}],"predecessor-version":[{"id":692,"href":"https:\/\/biodigestor.net\/index.php?rest_route=\/wp\/v2\/posts\/691\/revisions\/692"}],"wp:attachment":[{"href":"https:\/\/biodigestor.net\/index.php?rest_route=%2Fwp%2Fv2%2Fmedia&parent=691"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/biodigestor.net\/index.php?rest_route=%2Fwp%2Fv2%2Fcategories&post=691"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/biodigestor.net\/index.php?rest_route=%2Fwp%2Fv2%2Ftags&post=691"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}